Counting Nucleotides

Foundational Python Foundations DNA Strings Counting

Significance:

Every downstream tool in genomics — from base-calling QC to variant callers — starts with the
same primitive: knowing the base composition of a sequence. Nucleotide counting is also the first
check a bioinformatician runs against a FASTA file to sanity-test it, which is why it's the
"Hello World" of computational biology. It forces you to treat a string as a biological object
rather than just characters.

Statement

Given a single-stranded DNA sequence composed only of the characters A, C, G and T, count
how many times each nucleotide occurs.

Print four integers separated by single spaces, in the fixed order A C G T, on one line.

Input — read from standard input

Variable	Type	Description
`s` line 1	str	The DNA sequence to count bases in 1 <= len(s) <= 1000, uppercase A, C, G, T only

These variables are already read for you in the starter code on the right.

Output

str four space-separated counts in the order A C G T, on one line

Sample Cases

Sample 1

Input

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Expected Output

20 12 17 21

A 70-character sequence; each base counted in one linear pass.

Sample 2

Input

ACGT

Expected Output

1 1 1 1

Perfectly balanced — one of each base.

Submit also runs your code against 4 hidden test cases. Hidden inputs are never shown — if one fails you'll get its number and a description of the mismatch, not the data.

Constraints

1 <= length(s) <= 1000
s contains only uppercase A, C, G, T — no N, no lowercase, no internal whitespace