DNA to RNA Transcription

Foundational Transcription DNA RNA
Significance:
Transcription — copying the coding (sense) strand of DNA into mRNA by swapping thymine for uracil — is the literal first step of the Central Dogma (DNA → RNA → Protein), which gives this platform its name. Simulating it in code builds the mental model you'll need for every later problem involving RNA, splicing, or translation.
Statement

Given a DNA string representing the coding strand, produce the corresponding RNA string by replacing every `T` with `U`. All other characters remain unchanged and in the same order.

Sample Input
GATGGAACTTGACTACGTAAATT
Sample Output
GAUGGAACUUGACUACGUAAAUU
Constraints

- `1 ≤ length(DNA) ≤ 1000`
- Uppercase `A, C, G, T` only


My Notes
Log in to save personal notes.
Console output will appear here when you click Run Code or Submit...
Enter DNA / RNA / Protein test string
Next Problem
Reverse Complement