An RNA string is a string formed from the alphabet containing 'A', 'C', 'G', and 'U'. Given a DNA string *t*, return its transcribed RNA string *u* by replacing all occurrences of 'T' in *t* with 'U'.
Sample Input
GATGGAACTTGACTACGTAAATT
Sample Output
GAUGGAACUUGACUACGUAAAUU
Constraints
Length of DNA string <= 1000
Look into the replace() method.
My Notes
Log in to save personal notes.
Console output will appear here when you click Run Code or Submit...