Translating RNA into Protein

Intermediate Bioinformatics Translation Codon Protein

Significance:

Translation is the third and final step of the Central Dogma: the ribosome reads mRNA three bases
at a time and chains the corresponding amino acids. Implementing the codon table by hand is how
you internalise the genetic code's redundancy — and why synonymous mutations can be silent.

Statement

Given an RNA string whose length is a multiple of 3, translate it into a protein string using the
standard genetic code. Read the RNA in non-overlapping codons from left to right, appending the
single-letter amino acid code for each.

Stop as soon as you reach a stop codon (UAA, UAG, UGA) and do not include it in the
output. Print the protein string on one line.

Input — read from standard input

Variable	Type	Description
`rna` line 1	str	The RNA sequence to translate length is a multiple of 3, <= 1000, uppercase A, C, G, U only

These variables are already read for you in the starter code on the right.

Output

str the protein string in single-letter amino acid codes, stop codon excluded

Sample Cases

Sample 1

Input

AUGGCCAUGGCGCCCAGAACUGAGAUCAAUAGUACCCGUAUUAACGGGUGA

Expected Output

MAMAPRTEINSTRING

Translates to MAMAPRTEINSTRING; the final UGA is a stop codon and is not printed.

Sample 2

Input

AUGUAA

Expected Output

AUG gives M, then UAA halts translation immediately.

Submit also runs your code against 4 hidden test cases. Hidden inputs are never shown — if one fails you'll get its number and a description of the mismatch, not the data.

Constraints

length(rna) is always a multiple of 3, and at most 1000
Uppercase A, C, G, U only
Translation halts at the first stop codon; the stop codon itself is not printed