Computing GC Content

Foundational Bioinformatics GC Content DNA Statistics

Significance:

GC content correlates with gene density, melting temperature and genome stability, and it varies
systematically between organisms — which makes it a standard first-pass discriminator in
metagenomics and a required input to PCR primer design. It's also a practical lesson in
floating-point output formatting.

Statement

Given a DNA string, compute the percentage of its bases that are G or C.

Print the percentage rounded to exactly two decimal places (for example 60.92).

Your answer is compared numerically with a tolerance of 0.01, so small formatting differences
between Python and R are accepted.

Input — read from standard input

Variable	Type	Description
`s` line 1	str	The DNA sequence to measure 1 <= len(s) <= 1000, uppercase A, C, G, T only

These variables are already read for you in the starter code on the right.

Output

float the GC percentage, rounded to 2 decimal places

Sample Cases

Sample 1

Input

CCACCCTCGTGGTATGGCTAGGCATTCAGGAACCGGAGAACGCTTCAGACCAGCCCGGACTGGGAACCTGCGGGCAGTAGGTGGAAT

Expected Output

60.92

53 of the 87 bases are G or C.

Sample 2

Input

AAAA

Expected Output

0.00

No G or C at all, so the answer is 0.00.

Submit also runs your code against 4 hidden test cases. Hidden inputs are never shown — if one fails you'll get its number and a description of the mismatch, not the data.

Constraints

1 <= length(s) <= 1000
Uppercase A, C, G, T only — so the denominator is always length(s)